Reversible epigenetic alterations regulate class I HLA loss in prostate cancer

Reversible epigenetic alterations regulate class I HLA loss in prostate cancer

Analysis of public data sets

Genomic alteration data was accessed and analyzed in cBioPortal (RRID: SCR_014555)52,53. TCGA-PRAD data was accessed and downloaded through UCSC Xena54. Data from Taylor, et al. was accessed, analyzed, and downloaded through cBioPortal27. ATAC-seq data from Corces, et al. was accessed, analyzed, and downloaded through UCSC Xena54,55. Methylation beta values and matched gene expression values were accessed through Wanderer56. Probe information is listed in Supplementary Data S4. Prism 8 (GraphPad Prism, RRID: SCR_002798) was used for correlation analyses. Z-scores for gene expression and ATAC-seq were calculated with the following formula:

$${{\rmZ}}=\frac{{{\rm\chi }}-{{\rm\mu }}}{{{\rm\sigma }}}$$

(1)

where χ is the tumor or metastasis gene expression value, μ is the normal sample population mean, and σ is the normal sample population standard deviation. In the ATAC-seq data set, z-scores were calculated as compared to the tumor population, where χ is the tumor gene or ATAC-seq expression value, μ is the tumor sample population mean, and σ is the tumor sample population standard deviation.

COMPARE-MS

Patient samples used in this analysis were previously described30,33. COMPARE-MS was performed as previously described30,31,33. Briefly, DNA was digested with AluI and HhaI restriction enzymes (New England Biolabs, Cat# R0137L and Cat# R0139L) and enriched with MBD2-MBD protein (Takara Bio, Cat# 631962). Enriched DNA was subjected to qPCR with primers targeting HLA-A (Fwd: TCTGCGGGGAGAAGCAAG; Rev: GGGACACGGATGTGAAGAAA). Methylation index was calculated by normalizing Ct values from samples to controls (enzymatically methylated white blood cell DNA) to generate a Methylation Index from a range of 0.0–1.0.

Cell lines and cell culture

LAPC4 (ATCC, Cat# CRL-13009, RRID: CVCL_4744) were maintained in DMEM Medium (Corning) supplemented with 20% fetal bovine serum (FBS) (Gibco, Cat# 10437028), 1% sodium pyruvate (Corning, Cat# MT25000CI), 0.5% beta-mercaptoethanol, and 1% penicillin-streptomycin (HyClone, Cat# SV30010). LAPC4 cells were cultured in poly-d-lysine coated flasks and/or plates (BioCoat flasks: Corning, Cat# 0877260; 6-well plates: Sigma-Aldrich, Cat# Z720798-20EA). RWPE1 (ATCC Cat# CRL-11609, RRID: CVCL_3791, LNCaP (ATCC, Cat# CRL-1740, RRID: CVCL_1379), 22Rv1 (ATCC, Cat# CRL-2505, RRID: CVCL_1045), and PC3 (ATCC, Cat# CRL-1435, RRID: CVCL_0035) cells were maintained in RPMI 1640 Medium (Corning, Cat# MT10040CV) supplemented with 10% FBS, 1% sodium pyruvate, 1% penicillin-streptomycin, 1% non-essential amino acids (HyClone, Cat# SH30238.01), and 0.1% beta-mercaptoethanol. LCL (HCC2218-BL, ATCC, Cat# CRL-2363, RRID: CVCL_1264) cells were grown in suspension in RPMI 1640 Medium supplemented with 10% FBS and 1% penicillin-streptomycin. LCL, RWPE1, LNCaP, 22rv1, and PC3 were cultured in tissue culture treated flasks and/or plates (Flasks: Corning, Cat# 07202000; Plates: Thermo Fisher Scientific, Cat# 087721G). All cell lines were used in experiments within 30 passages from thaw. RWPE1, LNCaP, PC3, and LAPC4 were authenticated by short tandem repeat and tested for mycoplasma by PCR in 2017 at the TRIP Laboratory at the Department of Pathology, University of Wisconsin.

Ex vivo culture of prostate tissue

Human prostate tissues were obtained from patients undergoing radical prostatectomy at the University of Wisconsin-Madison. All patients were consented in writing under an Institutional Review Board (IRB) protocol #20130653. Research has been performed in accordance with the Declaration of Helsinki. All the laboratory investigators were blinded to clinical information. Absorbable gelatin sponges (Ethicon, Cat# 1973) were cut into pieces to fit in a 24-well tissue culture plate. Sponges were soaked in Ham’s F-12 media (Fisher Scientific, Cat# SH3002601) supplemented with 0.25 units/ml regular insulin (Sigma-Aldrich, Cat# I9278-5ML), 1 μg/mL hydrocortisone (Sigma-Aldrich, Cat# H0888-1g), 5 μg/mL human transferrin (Sigma-Aldrich, Cat# T8158-100mg), 2.7 mg/ml dextrose, 0.1 nM non-essential amino acids (HyClone, Cat# SH30238.01), 100 units/ml and 100 μg/mL Penicillin/Streptomycin, respectively (HyClone, Cat# SV30010), 2 mM L-glutamine (Corning, Cat# 25-005-CI), 25 μg/mL bovine pituitary extract (Life Technologies, Cat# 13028014), and 1% fetal bovine serum (FBS) (Gibco, Cat# 10437028) until fully saturated. Each core was cut into ~1 mm2 by 1 mm2 cubes. Tissue was placed on the sponges and cultured for up to 4 days at 37 °C at 5% CO2 and 500 μL media was replaced daily.

Immunoblotting

Whole-cell lysates were collected from adherent cells by scraping into RIPA buffer after washing with cold PBS. Whole-cell lysates were separated by SDS-PAGE and transferred onto nitrocellulose membrane. Membranes were blocked with SuperBlock blocking buffer (Thermo Scientific, Cat# 37515). Membranes were probed with primary antibodies diluted in 3% BSA in TBS plus 0.1% Tween-20 at 4 °C overnight followed by incubation with HRP-linked secondary antibody (BioLegend, Cat# 405306, RRID:AB_315009, 1:5000) at RT for 1 h and visualization by chemiluminescence. Primary antibodies: HLA-I clone W6/32 (BioLegend, Cat# 311412, RRID:AB_493132, 1:1000), α-tubulin (BioLegend, Cat# 627901, RRID:AB_439760, 1:1000).

Flow cytometry analysis of cell lines

Cells were stained with Ghost Dye Violet 510 (Tonbo Biosciences, Cat# 13-0870) to identify viable cells and PE-Cy7 conjugated anti-HLA-ABC antibody (BioLegend, Cat# 311430, RRID:AB_2561617). Intracellular staining for PSMB8 (LMP7)-PE (Abcam, Cat#EPR14482), Calreticulin-AlexaFluor647 (MBL International, Cat#K0136-4; RRID:AB_592808), and TAP-1-FITC (Abcam, Cat#EPR3924; RRID:AB_2819061) protein expression was performed following manufacturer’s protocol with BD Cytofix/Cytoperm kit (BD Biosciences, Cat#554714; RRID:AB_2869008). Samples were acquired on an LSR II instrument and data analyzed by the FlowJo software v9.9.6 (FlowJo, RRID: SCR_008520). Median Fluorescent Intensity was analyzed on gated live, single cells.

MBD2-MBD enrichment of methylated DNA from cell lines

Genomic DNA was isolated from cells using the AllPrep RNA/DNA Mini Kit (Qiagen, Cat# 80204) according to manufacturer’s instructions. DNA was quantified by a NanoDrop 1000 spectrophotometer and 1 μg DNA was sheared by sonication to an average size of around 200 bp. Methylated DNA was enriched from sheared genomic DNA using the EpiXplore Methylated DNA Enrichment Kit (Takara Bio, Cat# 631962) according to manufacturer’s instructions. Enrichment was measured by qRT-PCR using primers designed to various regions of HLA-A, HLA-B, and HLA-C (Integrated DNA Technologies). Primers are listed in Supplementary Data S5.

Chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP) was performed according to manufacturer’s instructions using the SimpleChIP Enzymatic Chromatin IP Kit with Magnetic Beads (Cell Signaling Technology, Cat# 9003S). Immunoprecipitation was performed using the following antibodies from Cell Signaling Technology: Histone H3 (Clone D2B12, Cat# 4620S, RRID: AB_1904005), H3K27ac (Clone D5E4, Cat# 8173S, RRID: AB_10949503), H3K27me3 (Clone C36B11, Cat# 9733S, RRID: AB_2616029), and IgG (Cat# 2729S, RRID: AB_1031062). DNA was then analyzed by qPCR using primers designed to target HLA-A, HLA-B, and HLA-C (Integrated DNA Technologies). Primers are listed in Supplementary Data S5. The H3K27ac signature in GM12878 determined by ChIP-seq from the ENCODE consortium35 was accessed in the UCSC Genome Browser (RRID: SCR_005780) to aid in primer design.

Epigenetic drug treatments of cell lines and ex vivo tissue

5-Aza-2′-deoxycytidine (5AZA2) (Sigma-Aldrich, Cat# A3656-5MG), Panobinostat (LBH, LBH589) (Selleckchem, Cat# S1030), and SGI-110 (SGI) (Astex Pharmaceuticals) were dissolved in DMSO and stored at −80 °C in aliquots. Cells were treated with 10 μM 5AZA2, 1 μM SGI, or DMSO for 72 h. 10 nM or 100 nM LBH was added for the last 24 h after 48 h of 5AZA2 or SGI treatment for combination treatments.

Gene expression analysis in cell lines

Total RNA was isolated from cells using the AllPrep RNA/DNA Mini Kit (Qiagen, Cat# 80204) according to manufacturer’s instructions. RNA was quantified by a NanoDrop 1000 spectrophotometer and 1 μg total RNA was reverse transcribed using the High Capacity RNA-to-cDNA kit (Thermo Fisher Scientific, Cat# 4388950). cDNA was diluted 10x and 5 μL was used per reaction for qPCR. Pre-designed TaqMan probes (Thermo Fisher) for HLA-A (Hs01058806_g1), HLA-B (Hs00818803_g1), and HLA-C (Hs00740298), and RPLP0 (4333761F) were used with iTaq Universal Probes Supermix (BioRad, Cat# 1725135). Gene expression was determined using the delta-delta-Ct method after normalization of each gene to housekeeping gene, RPLP0 (P0).

Gene expression analysis in epigenetic drug treated ex vivo tissue and 5AZA2/LBH-treated cell lines

Total RNA was isolated from cells using Rneasy Mini Kit (Qiagen, Cat# 74106) according to manufacturer’s protocol. Total RNA was isolated from ex vivo tissue using the Aurum Total RNA Fatty and Fibrous Tissue Kit (BioRad, Cat# 7326830) according to the manufacturer’s protocol. RNA was quantified by a NanoDrop 1000 spectrophotometer and 1 µg total RNA was reverse transcribed using iScript Reverse Transcription Supermix (Bio-Rad, Cat# 1708841). 1 µL of the cDNA synthesis reaction was used to perform qPCR using SsoAdvanced Universal SYBR Green Supermix (BioRad, Cat# 1725274) according to the manufacturer’s protocol. HLA-A, HLA-B, HLA-C, and RPLP0 primers are listed in Supplementary Data S5. Gene expression was determined using the delta-delta-Ct method after normalization of each gene to housekeeping gene, RPLP0 (P0).

Peptide vaccinations and T-cell co-culture

PSMA-specific CD8+ T-cells were generated by PSMA27-38 peptide vaccination of HHD transgenic humanized mice expressing human HLA-I A*02. The HHD mice were a generous gift from Professor Francois Lemonnier at the Pasteur Institute, Paris57. Research animals were maintained and experiments were performed in accordance with institutional guidelines overseen by the Institutional Animal Care and Use Committee of the University of Wisconsin. Mice were given once weekly subcutaneous injections of 100 μg synthetic PSMA peptide (VLAGGFFLL) (ProImmune, Oxford, UK) in 100 μL CFA (Thermo Fisher Scientific, Cat# NC0916022) for the first injection or IFA vehicle (Sigma-Aldrich, Cat# AR002) for subsequent injections. Splenocytes were harvested 1 week after last immunization and the number of live PSMA27-38-specific CD8+ splenocytes was determined by flow cytometry analysis following staining with GhostDye Violet 510 (Tonbo Biosciences, Cat# 13-0870), anti-mouse CD8 antibody (Tonbo Biosciences, Cat# 25-0081, RRID:AB_2621623) and Pro5 → PSMA27-38 A*02:01 MHC I pentamer (ProImmune, Oxford, UK). PSMA vaccinated splenocytes were then co-cultured with LNCaP cells that were pretreated with DMSO vehicle or 10 μM 5AZA2 or 1 μM SGI for 72 h and/or 10 nM LBH for the last 24 h in RPMI media supplemented with 10% FBS. In control co-culture wells, LNCaP cells were treated with 5 µg of purified anti-HLA-A,B,C blocking antibody (clone W6/32) (BioLegend, Cat# 311412, RRID:AB_493132) prior to adding splenocytes. Cells were co-cultured for 72 h and Golgi-stop (BD Biosciences, Cat# 554724) was added for the last 4 h of culture, following the manufacturer’s protocol. Cells were then harvested and subjected to labeling with Ghost Dye Violet 510 and surface markers: CD8 (Tonbo Biosciences, Cat# 25-0081, RRID:AB_2621623), Pro5 → PSMA27-38 A*02:01 MHC I pentamer (ProImmune), CD69 (BD Pharmigen, Cat# 551113, RRID:AB_394051), LFA-I (BD Biosciences, Cat# 558191, RRID:AB_397055), CD107 (BD Biosciences, Cat# 564347, RRID:AB_2738760), and CD16/CD32 Fc Block 2.4G2 (BD Biosciences Cat#553142) followed by fixation and permeabilization with BD Cytofix/Cytoperm (Thermo Fisher Scientific, Cat# 554714) according to the manufacturer’s protocol and intracellular staining with antibodies against murine IFNγ (Tonbo Biosciences, Cat# 20-7311, RRID:AB_2621616) and Granzyme B (BD Biosciences, Cat# 560211, RRID:AB_1645488). Cells were then washed and acquired on an LSR II Fortessa or an Attune NxT instrument followed by data analysis by the FlowJo software v9.9.6 (FlowJo, RRID: SCR_008520). Gating controls included the fluorescent minus one (FMO) strategy.

CTC capture, imaging, and analysis

Blood samples were collected from prostate cancer patients after receiving written informed consent under a protocol approved by the Institutional Review Board at the University of Wisconsin-Madison (#2014-1214). Research has been performed in accordance with the Declaration of Helsinki. Patients were required to have histologically confirmed prostate adenocarcinoma, and documented metastases, as confirmed on computed tomography (CT) or bone scanning with technetium-99m-labed methylene diphosphonate. Peripheral blood samples, for analysis of CTCs, were obtained from eligible patients at the time of disease evaluation. All the laboratory investigators were blinded to clinical information when determining CTC results. CTCs were processed and stained as previously described in Sperger et al.42. Briefly, PBMCs were isolated from whole blood on Ficoll-Paque PLUS (GE Healthcare, Cat# 45-001-750) gradient and fixed with Cytofix Fixation Buffer (BD Biosciences, Cat# 554655). Fixed cells were incubated with paramagnetic particles (PMPs) (Dynabeads® FlowComp™ Flexi kit, Life Technologies, Cat# 11061D) coated with biotinylated anti-EpCAM antibody (R&D Systems, Cat# AF960, RRID: AB_355745). The Versatile Exclusion-based Rare Sample Analysis (VERSA) platform was used for enrichment and staining of CTCs42,58,59. PMP bound cells were isolated in the VERSA and stained with Hoechst 33342 (Thermo Fisher, Cat# PI62249) and antibodies to the proteins indicated in the corresponding figures, which are summarized in Supplementary Data S6. Pan-cytokeratin was conjugated to Alexa Fluor 790 using the Alexa Fluor 790 Antibody Labeling Kit (Life Technologies, Cat# A20189) according to manufacturer’s instructions. All other antibodies were purchased pre-conjugated to the fluorophores listed in Supplementary Data S6. CD45, CD34, and CD11b were used on the same channel to serve as a white blood cell (WBC) “exclusion channel”. CD14 and CD27 were included in addition to CD45, CD34, and CD11b in the WBC exclusion channel for the experiment measuring extracellular HLA-I in CTCs only. Cells were stained for extracellular markers at 4 °C for 30 min. Cells were permeabilized and stained for intracellular antibodies with BD Perm/Wash at 4 °C overnight (BD Biosciences, Cat# BDB554723). Cells were imaged in the VERSA at 10x magnification using NIS Elements AR Microscope Imaging Software (NIS-Elements, RRID:SCR_014329) and analyzed using NIS Elements analysis software. CTCs were defined as positive for Hoechst and pan-cytokeratin and negative for CD45/34/11b or CD45/34/11b/14/27. All other cells were considered part of the WBC population.

Single-cell aspiration of CTCs for methylation analysis

CTCs enriched using the VERSA platform as described above were stained in the VERSA with Hoechst 33342 (Thermo Fisher, Cat# PI62249) and antibodies to HLA-A,B,C, EpCAM, CD27, CD45, CD34, and CD11b. Fluorophores, catalog numbers, and other antibody information is summarized in Supplementary Data S6. Patient characteristics for single-cell aspiration CTC samples are summarized in Supplementary Data S7. Cells were then further enriched using a single-cell aspiration platform, SASCA, previously developed by Tokar et al.39. Briefly, cells were seeded into polydimethylsiloxane (PDMS) microwells mounted on a glass microscope slide. The microwell array was imaged on a Nikon Ti-E Eclipse inverted fluorescent microscope. CTCs were identified as EpCAM positive, exclusion (CD45/CD34/CD11b/CD27) negative cells, whereas WBCs were defined as EpCAM negative, exclusion positive cells. CTCs were further subdivided into groups based on HLA-I positivity compared to WBCs in the same sample. Target cells were aspirated from microwells and dispensed into a droplet of PBS in the EXTRACTMAN extraction plate (Gilson, Cat# 22100008) to proceed with DNA extraction. Microarray images were analyzed using NIS Elements AR Microscope Imaging Software (NIS-Elements, RRID:SCR_014329) to obtain HLA-I mean fluorescent intensity (MFI) values.

DNA extraction from CTCs

DNA extraction was performed as previously described44. DNA was extracted using a semi-automated Gilson PIPETMAX liquid handling robot enabled for exclusion-based sample preparation (ESP), termed EXTRACTMAX60. The robot added LiDS buffer (90 mM Tris-HCL, 500 mM lithium chloride, 1% Igepal CA-630, 10 mM EDTA, 1 mM dithiothreitol) and MagneSil Paramagnetic Particles (PMPs) (Promega, Cat# MD1441) resuspended in GTC buffer (10 mM Tris-HCl, 6 M guanidinium thiocyanate, 0.1% Igepal CA-630, pH 7.5) to the extraction microplate (Gilson, Cat# 22100008). The robot then adds cells in suspension to the well-containing LiDS, GTC, and MagneSil beads. Cells are mixed in the buffer by the robot. Cells were lysed and DNA was allowed to bind to MagneSil PMPs for 5 min. The MagneSil PMPs with bound DNA were robotically transferred by exclusion liquid repellency (ELR) through one PBST (PBS containing 0.1% Tween-20) wash, one PBS wash, and eluted into 15 µL of nuclease-free water (Promega, Cat# P1197). DNA was eluted off of beads for 2 min following manual resuspension. The robot then transferred the MagneSil PMPs out of the elution well, leaving the eluted DNA in water.

MBD2-MBD enrichment of methylated DNA from CTCs

The SEEMLIS method of MBD2-MBD enrichment was performed44. 25 µL of TALON magnetic beads (Takara, Cat# 635637) were washed 3x with 100 µL 1x Binding Buffer (BB) (4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 120 mM NaCl, 2 mM Tris-HCl pH 7.4, 0.2% Tween-20, and 0.5 mM DTT). Beads were resuspended in 100 µL MBD2-MBD Coupling Buffer (1x BB, 1x Halt protease inhibitor cocktail (Thermo Scientific, Cat# PI87786), 500 ng Unmethylated Lambda DNA (Promega, Cat# D1521), and 5 µL tagged MBD2-MBD (EpiXplore Kit, Takara, Cat# 631962). TALON beads and MBD2-MBD are allowed to bind with shaking at RT for 1 h. DNA was digested using 1 µL of each restriction enzyme AluI at 10 units/µL (New England Biolabs, Cat# R0137L) and HpyCH4V at 5 units/µL (New England Biolabs, Cat# R0620L)) in 20 µL reactions containing 1x CutSmart Buffer (New England Biolabs, Cat# B7204S) for 15 min at 37 °C followed by enzyme inactivation for 20 min at 80 °C. MBD2-MBD bound beads were washed 3x with 100 µL 1x BB and resuspended in 88 µL 1x BB with 1x Halt protease inhibitor cocktail and added to 20 µL restriction enzyme digested DNA in 200 µL PCR tubes. This reaction was placed on a shaker at RT for 3 h to bind methylated DNA to MBD2-MBD conjugated TALON beads. PCR tubes were placed onto the Gilson PIPETMAX liquid handling robot (EXTRACTMAN system enabled for ESP as previously described58) for washing and elution steps. The robot transferred the whole volume from the PCR tubes onto the extraction microplate (Gilson, Cat# 22100008) and then magnetically transferred the TALON beads through a wash containing 1x BB with 1x Halt protease inhibitor cocktail and into 15 µL of water for elution. The whole elution volume including beads was manually pipetted into new 200 µL PCR tubes containing pre-amplification reaction mix and placed into the thermocycler under manufacturer recommended pre-amplification cycling conditions defined below. Volumes indicated are per reaction.

Pre-amplification and qPCR of MBD2-MBD enriched DNA from CTCs

Quantitative PCR was performed using custom TaqMan hydrolysis probes (Applied Biosystems) and iTaq Universal Probes Supermix (Bio-Rad, Cat# 1725153). Primer and probe sequences are listed in Supplementary Data S5. Cycling conditions: 5 min at 95 °C for initial denaturation and enzyme activation followed by 45 amplification cycles of 5 s at 95 °C and 30 s at 60 °C. Pre-amplification was performed using the custom hydrolysis probes and TaqMan PreAmp Master Mix (Applied Biosystems, Cat# 4488593) when indicated according to manufacturer specifications. Cycling conditions: 10 min at 95 °C for enzyme activation followed by 14 cycles of 95 °C for 15 s and 60 °C for 4 min. Pre-amplified samples were diluted 1:5 with TE buffer. Ct values were transformed into relative methylation values by the following equation:

$${{{\rmRelative}}}\,{{{\rmmethylation}}}\,=2^{-(\rmCt-{{{\rmMCV}}})}$$

(2)

Where MCV is the max cycle value, which is the Ct cut off pre-determined by cell line validation studies for each gene. For HLA-I, MCV is equal to 33. For LINE1, MCV is equal to 45. A Methylation Index from 0.0 to 1.0 was also calculated for each patient using LNCaP methylation as 1.0 on the Methylation Index scale. Raw Ct values were converted to relative values using the delta Ct method and then divided by the relative methylation in LNCaP cells as follows:

$${{{\rmMethylation}}}\,{{{\rmIndex}}}=\frac{2^{-{{{{{\rmCt}}}}}_{{{{\rmCTC}}}}}}{2^{{-{{{{{{\rmCt}}}}}}}_{{{{\rmLNCaP}}}}}}$$

(3)

Statistics and reproducibility

Survival curve analysis was performed using the log-rank (Mantel-Cox) test. For the HLA-I genomic alteration and HLA-I protein expression studies, comparison between groups was made with an ordinary one-way ANOVA followed by post hoc analysis with the Tukey test for correction of multiple comparisons. Comparisons between average methylation beta values in tumor vs. normal samples from the PRAD data set were made by unpaired t-test with Welch’s correction. Comparisons between methylation beta values across gene expression subgroups were made with an ordinary one-way ANOVA followed by post hoc analysis with the Tukey test for correction of multiple comparisons. For baseline gene expression and ChIP experiments, comparisons between groups were made with two-way ANOVA using the Dunnett method for correction of multiple comparisons. For drug treatment gene expression experiments, comparisons between DMSO and treatment groups were made by t-test corrected for multiple comparisons by the Holm-Sidak method or by one-way ANOVA with Dunnett’s correction when comparing DMSO to multiple treatment groups. For CTC MFI experiments, comparisons were made by Kruskal–Wallis test using the Dunn’s method for correction of multiple comparisons. Gene expression statistical analyses were performed on delta-Ct values. All statistical analyses were performed in Prism 8 (GraphPad Prism, RRID: SCR_002798). Sample sizes are indicated in the text and figure legends or original documentation in the case of public data sets.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Miss Virginia Victoria Chuah partners with Virginia ABC to teach students about making healthy choices Previous post Miss Virginia Victoria Chuah partners with Virginia ABC to teach students about making healthy choices
Fears for patient safety with hundreds of medicines in short supply Next post Fears for patient safety with hundreds of medicines in short supply